The side population (SP) phenotype is associated with the Hoechst dye efflux activity of the Abcg2 transporter and identifies hematopoietic stem cells (HSCs) in the bone marrow. their progeny were identified following treatment with tamoxifen (Tam). In the liver and kidney in which mature cells express Abcg2 reporter gene expression verified the expected physiologic expression pattern PIK-75 of the recombinant allele. Long term marking of HSCs was seen in multiple peripheral blood lineages from adult mice demonstrating that Abcg2+ bone marrow HSCs contribute to steady PIK-75 state hematopoiesis. Stem cell tracing patterns were seen in the small intestine and in seminiferous tubules in the testis twenty months after Tam treatment proving that stem cells from these organs express Abcg2. Interstitial cells from skeletal and cardiac muscle were labeled and some cells co-stained with endothelial markers raising the question as to whether these may function as tissue-specific muscle stem cells. Altogether these studies prove PIK-75 that Abcg2 is a stem cell marker for blood small intestine and testicular germ cells and provide a IL1R new model for studying stem cell activity that does not require transplant-based assays. allele PIK-75 that expressed both the endogenous Abcg2 open reading frame along with an ires-GFP gene inserted into a non-coding region of Abcg2[7]. This recombinant allele retained the normal physiologic expression pattern of wildtype mouse model An ires-CreERT2 gene[14] PIK-75 was inserted into the 3’ untranslated region of exon 16 of the allele in order to establish spatiotemporal gene control via Tam-mediated pulse-chase tracing. The ires-CreERT2 fragment was used to replace the ires-GFP fragment from within our prior targeting construct used to create the Abcg2GFP knock-in mouse model[7]. The resulting construct was electroporated into the murine embryonic stem cell line ES129SVJ-F12 (provided by Dr. Gerard Grosveld St. Jude Children’s Research Hospital) and selected with ganciclovir and G418 to generate Abcg2-NeoR-ires-CreERT2pA ES cells. One karyotypically normal and correctly targeted ES cell clone was transiently electroporated with a pMC-Cre plasmid[15] to delete the Neomycin resistance gene (NeoR) and subclones were selected. The final Abcg2-ires-CreERT2pA ES cell clone was injected into mouse C57Bl/6J blastocysts and chimeric mice were used to establish germline transmission. All experiments with mice were done according to a protocol approved by the St. Jude Children’s Research Hospital Institutional Animal Care and Use Committee. ES cells and mice were genotyped either by Southern blot or by PCR using primers as show in Figure 1. The sequence of the primers are P1: PIK-75 5’ TCAGGGCATCGAACTGTC 3’. P2: 5’ CGCCTTTGCAGGTGTATC 3’ P3: 5’ CCAAACAAGCCTCGACCTAC 3’. Primers P1 and P2 amplify a 723bp fragment spanning exon 16 of Abcg2 and the Cre fragment. Primers P1 and P3 amplify a 463bp fragment from the wild type allele. The outside probe for Southern blot was generated by PCR and encompasses a fragment between exon 14 and intron 14. Figure 1 Targeted insertion of the expression cassette into the Abcg2 locus Tamoxifen treatment of mice Tamoxifen (Tam) (Sigma-Aldrich USA) was dissolved in corn oil at a concentration of 20 mg/ml. Adult gene: – Forward: 5’ GTGCCACCATGTTCAACTTA 3’ Reverse: 5’ CTGCCAGAGTAGTGGAAGATT 3’. For the detection of Cre-mediated excised stop-cassette the assay was done using Dream Taq Green PCR Master mix 2X (K1081 Fermentas USA) and 35 cycles of amplification. For detection of the endogenous Abcg2 loading control HotStar Taq DNA Polymrase (203203 Qiagen USA) was used with 40 cycles of amplification. PCR products were analyzed by ethidium bromide staining of agarose gels. Results Generation and breeding of mice Homologous recombination was used to generate ES cell clones in which an ires-CreERT2 cassette was inserted into exon 16 of the allele (Fig 1A). This CreERT2 expression cassette was inserted downstream of the stop codon and upstream of the endogenous polyadenylation signal sequence to ultimately generate a bicistronic mRNA that expresses both wildtype Abcg2 and the CreERT2 fusion gene. We have previously used the same recombination arms to express an ires-GFP construct from the Abcg2 locus and showed that tissue specific expression was preserved for both genes [7]. Three ES cell clones were isolated after selection with G418 and gancyclovir. The NeoR gene was deleted by transient transfection of a Cre expression plasmid to yield ES clones containing the final recombinant or the gene is then expressed via the.